| spacefill | wire | ball&stick | cartoons | fancy | not | flat | color atomno | color cpk | color structure | isosurface vdw | off | mep | translucent | opaque |
| ID | 1CQL_A | Cluster | 32 |
|---|---|
| RFAM | unassigned |
| Sequence | GGCGUUUACCAGGUCAGGUCCGGAAGGAAGCAGCCAAGGCGCC |
| center structure | 5GAG_1 |