| spacefill | wire | ball&stick | cartoons | fancy | not | flat | color atomno | color cpk | color structure | isosurface vdw | off | mep | translucent | opaque |
| ID | 1EVV_A | Cluster | 16 |
|---|---|
| RFAM | RF00005 |
| Sequence | GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA |
| center structure | 5ME1_X |