| spacefill | wire | ball&stick | cartoons | fancy | not | flat | color atomno | color cpk | color structure | isosurface vdw | off | mep | translucent | opaque |
| ID | 1HC8_C | Cluster | 26 |
|---|---|
| RFAM | RF02541 |
| Sequence | GCCAGGAUGUAGGCUUAGAAGCAGCCAUCAUUUAAAGAAAGCGUAAUAGCUCACUGGU |
| center structure | 5DAR_A |